View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16815_low_68 (Length: 260)
Name: NF16815_low_68
Description: NF16815
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16815_low_68 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 78; Significance: 2e-36; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 72 - 157
Target Start/End: Original strand, 1390727 - 1390812
Alignment:
| Q |
72 |
caaaccctaacctgcgataatctcagaatcagtccaatcggtgaatcacctttgattttattactctgaaaggttagtgaaccacc |
157 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
1390727 |
caaaccctaacctgcgataatctctgaatcagtccaatcggtgaatcacctttggttttattactctgaaaggttagtgaaccacc |
1390812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000003; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 116 - 152
Target Start/End: Original strand, 15328467 - 15328503
Alignment:
| Q |
116 |
atcacctttgattttattactctgaaaggttagtgaa |
152 |
Q |
| |
|
|||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
15328467 |
atcaccattgattttattgctctgaaaggttagtgaa |
15328503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 116 - 152
Target Start/End: Original strand, 15508836 - 15508872
Alignment:
| Q |
116 |
atcacctttgattttattactctgaaaggttagtgaa |
152 |
Q |
| |
|
|||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
15508836 |
atcaccattgattttattgctctgaaaggttagtgaa |
15508872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University