View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16815_low_80 (Length: 234)
Name: NF16815_low_80
Description: NF16815
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16815_low_80 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 134; Significance: 7e-70; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 19 - 152
Target Start/End: Original strand, 28089438 - 28089571
Alignment:
| Q |
19 |
cgaatagtgtcggagatgttggaccaagattgttaaggagcagtggaaagagaagggattggtgtttggatgaattgcttggacaacaagaaaatggagt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28089438 |
cgaatagtgtcggagatgttggaccaagattgttaaggagcagtggaaagagaagggattggtgtttggatgaattgcttggacaacaagaaaatggagt |
28089537 |
T |
|
| Q |
119 |
tgaatgccattgatgaaatatttcactaaattac |
152 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
28089538 |
tgaatgccattgatgaaatatttcactaaattac |
28089571 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 174 - 226
Target Start/End: Original strand, 43092756 - 43092808
Alignment:
| Q |
174 |
ttaataccagtaaaaattaacattggattagataatgtccgctctcaccctat |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
43092756 |
ttaataccagtaaaaattaacattggattagataatgtccgctctcacactat |
43092808 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University