View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16815_low_81 (Length: 232)
Name: NF16815_low_81
Description: NF16815
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16815_low_81 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 16 - 217
Target Start/End: Original strand, 30761024 - 30761225
Alignment:
| Q |
16 |
atgaatagccataagtggaaaatcttaaatatgctaatggaaatagtgagagtgccttagaattgattactttggaataaggaaagttagaaagatcaac |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30761024 |
atgaatagccataagtggaaaatcttaaatatgctaatggaaatagtgagagtgccttagaattgattactttggaataaggaaagttagaaagatcaac |
30761123 |
T |
 |
| Q |
116 |
attgcaatggcttgtataaatagtgattgatgtggttattgttgtaattgtcatatgatcgaatttgattaattagaaatgtttaaaattgatcttagaa |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30761124 |
attgcaatggcttgtataaatagtgattgatgtggttattgttgtaattgtcatatgatcgaatttgattaattagaaatgtttaaaattgatcttagaa |
30761223 |
T |
 |
| Q |
216 |
gt |
217 |
Q |
| |
|
|| |
|
|
| T |
30761224 |
gt |
30761225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University