View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16815_low_81 (Length: 232)

Name: NF16815_low_81
Description: NF16815
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16815_low_81
NF16815_low_81
[»] chr6 (1 HSPs)
chr6 (16-217)||(30761024-30761225)


Alignment Details
Target: chr6 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 16 - 217
Target Start/End: Original strand, 30761024 - 30761225
Alignment:
16 atgaatagccataagtggaaaatcttaaatatgctaatggaaatagtgagagtgccttagaattgattactttggaataaggaaagttagaaagatcaac 115  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30761024 atgaatagccataagtggaaaatcttaaatatgctaatggaaatagtgagagtgccttagaattgattactttggaataaggaaagttagaaagatcaac 30761123  T
116 attgcaatggcttgtataaatagtgattgatgtggttattgttgtaattgtcatatgatcgaatttgattaattagaaatgtttaaaattgatcttagaa 215  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30761124 attgcaatggcttgtataaatagtgattgatgtggttattgttgtaattgtcatatgatcgaatttgattaattagaaatgtttaaaattgatcttagaa 30761223  T
216 gt 217  Q
    ||    
30761224 gt 30761225  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University