View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16815_low_86 (Length: 217)
Name: NF16815_low_86
Description: NF16815
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16815_low_86 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 201
Target Start/End: Original strand, 28324788 - 28324989
Alignment:
| Q |
1 |
ctcttcccactttcccaagctttcaaggttacatttttcaattaataccacaaatccc-aatttcaaagtattaattcaattcattcatgttgtttaagc |
99 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28324788 |
ctcttcccactttcccaagctttcaagtttacatttttcaattaataccacaaatccccaatttcaaagtattaattcaattcattcatgttgtttaagc |
28324887 |
T |
|
| Q |
100 |
ttaatcatatccattgtaatgaccctttgttcattctcttctcttctatccatatccattcatgattcttcaacaagcttctcctacttttcacttctct |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28324888 |
ttaatcatatccattgtaatgaccctttgttcattctcttctcttctatccatatccattcatgattcttcaacaagcttctcctacttttcacttctct |
28324987 |
T |
|
| Q |
200 |
ct |
201 |
Q |
| |
|
|| |
|
|
| T |
28324988 |
ct |
28324989 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University