View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16816_high_19 (Length: 265)
Name: NF16816_high_19
Description: NF16816
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16816_high_19 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 84; Significance: 5e-40; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 50 - 161
Target Start/End: Complemental strand, 9574558 - 9574447
Alignment:
| Q |
50 |
aaactactcacttatacaaacacagactgggctggatgtcccaacaaaagaagatatatctcttattattgagtatatattggtgataatttgatctctt |
149 |
Q |
| |
|
||||||||| |||||||||||| |||||||||| |||||||| ||| |||||||||||||||| ||||||||||||||||||||||||| |||||||||| |
|
|
| T |
9574558 |
aaactactcgcttatacaaacatagactgggctagatgtcccgacacaagaagatatatctctaattattgagtatatattggtgataacttgatctctt |
9574459 |
T |
|
| Q |
150 |
attatgcaaaaa |
161 |
Q |
| |
|
|||||||||||| |
|
|
| T |
9574458 |
attatgcaaaaa |
9574447 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 160 - 249
Target Start/End: Complemental strand, 9574707 - 9574618
Alignment:
| Q |
160 |
aagatcaaatatctcttctgaagttcaagaagtgtgcttgtttatacataacccaaaaacacaacacatgtctttttgaaaagtattatt |
249 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
9574707 |
aagatcaaatatctcttatgaagttcaagaagtgtgcttgtttatacataccccaaaaacacaacacatgtctttatgaaaagtattatt |
9574618 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 1 - 29
Target Start/End: Complemental strand, 9574605 - 9574577
Alignment:
| Q |
1 |
ggcactattgagtttagcctcaacctata |
29 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
9574605 |
ggcactattgagtttagcctcaacctata |
9574577 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University