View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16816_high_8 (Length: 426)
Name: NF16816_high_8
Description: NF16816
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16816_high_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 63; Significance: 3e-27; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 98 - 168
Target Start/End: Complemental strand, 25729429 - 25729359
Alignment:
| Q |
98 |
agtgtgggttgctctatgataccattatatattagcttgcaattgacaacgaagaaatgaactttaacgtc |
168 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
25729429 |
agtgtgggttgctctatgatactattatatattagcttgcaattgacaacgaagaaatgagctttaacgtc |
25729359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 14 - 48
Target Start/End: Complemental strand, 25729480 - 25729446
Alignment:
| Q |
14 |
atatcttttggttgactctacatcgacatggatgg |
48 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |
|
|
| T |
25729480 |
atatcttttggttgactcgacatcgacatggatgg |
25729446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University