View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16817_low_22 (Length: 453)
Name: NF16817_low_22
Description: NF16817
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16817_low_22 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 372; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 372; E-Value: 0
Query Start/End: Original strand, 46 - 449
Target Start/End: Original strand, 53982273 - 53982676
Alignment:
| Q |
46 |
gaagggcagtgctgcagcaatgcagcaactggacagcgagtagtgcagaaggcggccacatgagattatggtttgttggtaggggaaagatcctcaagga |
145 |
Q |
| |
|
|||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53982273 |
gaagggcaatgctgctgcaatgcagcaactggacagcgagtagtgcagaaggcggccacatgagattatggtttgttggtaggggaaagatcctcaagga |
53982372 |
T |
|
| Q |
146 |
ggcgcgagcatgacggctaggcacaaccatggaatcacactacagaggcgtggtagggcagccacttatcccaacttaggttttgggactatggagtgtc |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53982373 |
ggcgcgagcatgacggctaggcacaaccatggaatcacactacagaggcgtggtagggcagccacttatcccaacttaggttttgggactatggagtgtc |
53982472 |
T |
|
| Q |
246 |
caagctttttataagtttttattaggaaccatttctattcaatgtcaggattagattttcactatacaaaacaagtatataaataaagtcaaacaagtat |
345 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
53982473 |
caagctttttataagtttttagtaggaaccatttctattcaatgtcaggattagattttcactatacaaagcaagtatataaataaagtcaaacaagtat |
53982572 |
T |
|
| Q |
346 |
taacaaaagataaattgcttcactaactgagtagaggccttctctcaagcaagcaaacggccttcgcagtttcactgccttcttcatcaatagtattatc |
445 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||| |
|
|
| T |
53982573 |
taacaaaagataaattccttcactaactgagtagaggccttctctcaagcaagcaaacggcctccgcagtttcactgccttcttcatcaatagcattatt |
53982672 |
T |
|
| Q |
446 |
tacc |
449 |
Q |
| |
|
|||| |
|
|
| T |
53982673 |
tacc |
53982676 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University