View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16817_low_40 (Length: 343)
Name: NF16817_low_40
Description: NF16817
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16817_low_40 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 7 - 332
Target Start/End: Original strand, 36253128 - 36253453
Alignment:
| Q |
7 |
attctcacaataagtcaaattgttaccataaagacatgctgcttgaattcatatttgagtatacaattaaacatttagttgatcaaggatgaaaacaaag |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36253128 |
attctcacaataagtcaaattgttaccataaagacttgctgcttgaattcatatttgagtatacaattaaacatttagttgatcaaggatgaaaacaaag |
36253227 |
T |
|
| Q |
107 |
tatttcatctacgtggtctctctttgtgcactattgcttacctctgttgtggcaatcaagccatcaaaagatgaaatgcaatgtatatacttatgttttt |
206 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||| ||||||||||||||| | |||||||||||||||||| |||||||||||| || ||| |
|
|
| T |
36253228 |
tatttcatcttcgtggtctctctttgtgcactattgcttttctctgttgtggcaattaggccatcaaaagatgaaatacaatgtatatacatagacattt |
36253327 |
T |
|
| Q |
207 |
tgtac-aattgctttcttctcttattatacataataattgtgtttatttgatttgtagatggtgcaactaaagaatctaaaacaaaaactagtgtagata |
305 |
Q |
| |
|
|| || | || ||||||||||||||||| ||||||||||||||| ||| ||||| ||||||||||||| |||||||||||||||||||||| ||||||| |
|
|
| T |
36253328 |
tgcacgattttttttcttctcttattatatataataattgtgttt-ttttatttgcagatggtgcaactgaagaatctaaaacaaaaactagggtagata |
36253426 |
T |
|
| Q |
306 |
tatatagaggttcgggaggaggtggac |
332 |
Q |
| |
|
||||||||||| |||||||||||||| |
|
|
| T |
36253427 |
catatagaggttggggaggaggtggac |
36253453 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University