View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16817_low_51 (Length: 291)
Name: NF16817_low_51
Description: NF16817
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16817_low_51 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 161; Significance: 7e-86; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 161; E-Value: 7e-86
Query Start/End: Original strand, 16 - 205
Target Start/End: Original strand, 10477378 - 10477567
Alignment:
| Q |
16 |
aattctgcatattcatctgtatttttgaattttgagtatatctacaaacatggtttttagccaatttgtttgtcttattgaggaggagaagacatcgcag |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||| |
|
|
| T |
10477378 |
aattctgcatattcatctgtatttttgaattttgagtatatctacaaacatggtttttagccaatttgtttgtcttattgaagaggagaagacatcacag |
10477477 |
T |
 |
| Q |
116 |
aatgatgatagcaactcaacttcatgttcaacnnnnnnnggtttgatagattttttcatatattcaacattattcatcagaatacaaaag |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10477478 |
aatgatgatagcaactcaacttcatgttcaactttttttggtttgatagattttttcatatattcaacattattcatcagaatacaaaag |
10477567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 229 - 277
Target Start/End: Original strand, 10477591 - 10477639
Alignment:
| Q |
229 |
ccttctctgccaacttcgttccggtgactacaaagtaaagggagagaag |
277 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
10477591 |
ccttctctgccaacttcgttccggtgactacgaagtaaagggagagaag |
10477639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 53; Significance: 2e-21; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 37 - 137
Target Start/End: Original strand, 2855474 - 2855574
Alignment:
| Q |
37 |
tttttgaattttgagtatatctacaaacatggtttttagccaatttgtttgtcttattgaggaggagaagacatcgcagaatgatgatagcaactcaact |
136 |
Q |
| |
|
||||||| |||||||||||||| |||||||||||||| ||||| |||||| |||||||| ||||| || |||| ||||||||||| |||||||||||| |
|
|
| T |
2855474 |
tttttgagttttgagtatatctgcaaacatggtttttcgccaacttgtttatcttattgcagaggaaaacacattacagaatgatgaaagcaactcaact |
2855573 |
T |
 |
| Q |
137 |
t |
137 |
Q |
| |
|
| |
|
|
| T |
2855574 |
t |
2855574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University