View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16817_low_64 (Length: 253)
Name: NF16817_low_64
Description: NF16817
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16817_low_64 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 1 - 248
Target Start/End: Original strand, 21929856 - 21930106
Alignment:
| Q |
1 |
atgattgaaaaagaagattacctcaaaaagcaagctaggtgagttaaaaaaggaaaagtcttgtgcattagatccaaaagggtaaccaaaagtactacca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
21929856 |
atgattgaaaaagaagattacctcaaaaagcaagctaggtgagttaaaaaaggaaaagtcttgtgcattagatccaaaagggtaaccaaaagtgctacca |
21929955 |
T |
 |
| Q |
101 |
acaaaatggttactaatcatattattatgattgagttgacaatgatgaacatgtagttgttgttg---tnnnnnnnnnnnnnnnnnnnntagctgcagtt |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||| |
|
|
| T |
21929956 |
acaaaatggttactaatcatattattatgattgagttgacaatgatgaacatgtagttgttgttgttgttgctgctgctgctgctgctgtagctgcagtt |
21930055 |
T |
 |
| Q |
198 |
gtttgttaagtttccttcttaacttctgtctatccctagccctatgcttct |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||| |||| |
|
|
| T |
21930056 |
gtttgttaagtttccttcttaacttctgtctatccctagccttatgattct |
21930106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University