View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16817_low_72 (Length: 241)
Name: NF16817_low_72
Description: NF16817
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16817_low_72 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 54; Significance: 4e-22; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 37 - 152
Target Start/End: Complemental strand, 12061781 - 12061670
Alignment:
| Q |
37 |
taaaaatgtttgaaccttctttattnnnnnnntataatctaatatagattcaacgtaggttaaaccatagacctaagtcggtcattcaccattgttacat |
136 |
Q |
| |
|
||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||| || ||||| | ||||||||| |
|
|
| T |
12061781 |
taaaaatgtttgaaccttctttattaaaaaaatataatttaatatagattcaacgtaggttaaaccatagaccta----tgttattcatcgttgttacat |
12061686 |
T |
 |
| Q |
137 |
aaatatgaactgatcc |
152 |
Q |
| |
|
|| ||||||||||||| |
|
|
| T |
12061685 |
aattatgaactgatcc |
12061670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 207 - 241
Target Start/End: Complemental strand, 12061616 - 12061582
Alignment:
| Q |
207 |
tccactataacttgaattcgatttttaaaattcct |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
12061616 |
tccactataacttgaattcgatttttaaaattcct |
12061582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University