View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16818_high_17 (Length: 272)
Name: NF16818_high_17
Description: NF16818
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16818_high_17 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 13 - 253
Target Start/End: Original strand, 40114335 - 40114575
Alignment:
| Q |
13 |
gtacatggtcacgcactctcgcagaatcttagtcgttgaatgaagatcaggcaggtcgtattgtgacttcactaaaccaactttaaaaatatagctcaaa |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40114335 |
gtacatggtcacgcactctcgcagaatcttagtcgttgaatgaggatcaggcaggtcgtattgtgacttcactaaaccaactttaaaaatatagctcaaa |
40114434 |
T |
 |
| Q |
113 |
acaagagtcgtctgatcttcatctaacacaaagatcggcaattattggtcgtgtcaatgtagataatctgatttcagctaaacaaaattatttaagttat |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40114435 |
acaagagtcgtctgatcttcatctaacacaaagatcggcaattattggtcgtgtcaatgtagataatctgatttcagctaaacaaaattatttaagttat |
40114534 |
T |
 |
| Q |
213 |
taatcaatagattcaataccatatagcactgatgctagact |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
40114535 |
taatcaatagattcaataccatatagcactgaagctagact |
40114575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University