View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16818_high_19 (Length: 270)
Name: NF16818_high_19
Description: NF16818
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16818_high_19 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 11 - 255
Target Start/End: Original strand, 2834120 - 2834364
Alignment:
| Q |
11 |
cataggagattactattacaaattgttcccggtaagtaactagcgtctcggcttaacatggttgtaccaaatttttcttaagaacaatagttaaatgctc |
110 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2834120 |
cataggagattactattacaatttgttcccggtaagtaactagcgtctcagcttaacatggttgtaccaaatttttcttaagaacaatagttaaatgctc |
2834219 |
T |
|
| Q |
111 |
gtcttacaaagaatgtcaactggaaagtttctgtttctgattaaattatttgagacttcatgaaatatgagatgaattattgattatatgctttgtttca |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2834220 |
gtcttacaaagaatgtcaactggaaagtttctgtttctgattaaattatttgagacttcatgaaatatgagatgaattattgattatatgctttgtttca |
2834319 |
T |
|
| Q |
211 |
ctctgaagaaatatcatccttcaagggtacttacattggtttatc |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2834320 |
ctctgaagaaatatcatccttcaagggtacttacattggtttatc |
2834364 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University