View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16818_high_26 (Length: 227)
Name: NF16818_high_26
Description: NF16818
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16818_high_26 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 115; Significance: 1e-58; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 7 - 121
Target Start/End: Complemental strand, 16272430 - 16272316
Alignment:
| Q |
7 |
ataccatagtgtctctcaacgacaaaaggtgaagtcttgggtcttcttttgtgctctcaagtgggtgagggacatggaacatcaacaagtcatctttgag |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16272430 |
ataccatagtgtctctcaacgacaaaaggtgaagtcttgggtcttcttttgtgctctcaagtgggtgagggacatggaacatcaacaagtcatctttgag |
16272331 |
T |
 |
| Q |
107 |
gttgattgcaagata |
121 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
16272330 |
gttgattgcaagata |
16272316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University