View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16818_high_29 (Length: 215)
Name: NF16818_high_29
Description: NF16818
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16818_high_29 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 151; Significance: 4e-80; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 151; E-Value: 4e-80
Query Start/End: Original strand, 18 - 198
Target Start/End: Complemental strand, 36950073 - 36949896
Alignment:
| Q |
18 |
gtgtgtggcggcacgatgagcagcagccatttataaatgggttcactgacacagtgaacactatttcggtggcagaacaatatatgttacatggaatgcc |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
36950073 |
gtgtgtggcggcacgatgagcagcagccatttataaacgggttcactgacacagtgaacactatttcggtggcagaaccatatatgttacatggaatgcc |
36949974 |
T |
|
| Q |
118 |
tagtagatcagatatgcagcagcttattaatgtcaatagacacatggtatgttttttctcccttcccatctatgccccctt |
198 |
Q |
| |
|
|||||||||| |||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36949973 |
tagtagatcacatat---gcaccttattaatgtcaatagacacatggtatgttttttctcccttcccatctatgccccctt |
36949896 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 111 - 198
Target Start/End: Original strand, 10818104 - 10818191
Alignment:
| Q |
111 |
gaatgcctagtagatcagatatgcagcagcttattaatgtcaatagacacatggtatgttttttctcccttcccatctatgccccctt |
198 |
Q |
| |
|
||||||||||||||||| ||||||| | | |||||||| |||||||||||||||||| |||||||||| ||||| ||||||||| |
|
|
| T |
10818104 |
gaatgcctagtagatcacatatgcaacgtgacaataatgtcactagacacatggtatgtttattctcccttctcatctttgccccctt |
10818191 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University