View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16818_low_18 (Length: 320)
Name: NF16818_low_18
Description: NF16818
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16818_low_18 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 276; Significance: 1e-154; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 276; E-Value: 1e-154
Query Start/End: Original strand, 1 - 288
Target Start/End: Complemental strand, 31138708 - 31138421
Alignment:
| Q |
1 |
tctctttcccttcgatatctatcctgatcatgattgtttccaaccccagtgagagcttgttgtcaatcagatagtttttgcactattctgattgttttcc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31138708 |
tctctttcccttcgatatctatcctgatcatgattgtttccaaccccagtgagagcttgttgtcaatcagatagtttttgcactattctgattgttttcc |
31138609 |
T |
|
| Q |
101 |
cttttattgtttattcgccactattgttctattctcatgcataggatattaggataccatattcatatgacactctagtagtctttgaaggctagctcta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31138608 |
cttttattgtttattcgccactattgttctattctcatgcataggatattaggatatcatattcatatgacactctagtagtctttgaaggctagctcta |
31138509 |
T |
|
| Q |
201 |
gtttgaatttatccgagttcatgtccaaactatgcatttaacaacattgtgttgcttatcaacaaaatatggctgatattgctcctag |
288 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
31138508 |
gtgtgaatttatccgagttcatgtccaaactatgcatttaacaacattgtgttacttatcaacaaaatatggctgatattgctcctag |
31138421 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 1 - 144
Target Start/End: Original strand, 31102279 - 31102423
Alignment:
| Q |
1 |
tctctttcccttcgatatctatcctgatcatgattgtttccaacccc-agtgagagcttgttgtcaatcagatagtttttgcactattctgattgttttc |
99 |
Q |
| |
|
|||||| ||||| ||||||||||||| |||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
31102279 |
tctcttccccttagatatctatcctggtcatgattgtttccaacccccagtgagagcttgttgtcaatcgaatagtttttgcactattctgattgttttc |
31102378 |
T |
|
| Q |
100 |
ccttttattgtttattcgccactattgttctattctcatgcatag |
144 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31102379 |
ccttttattgtttattcgccactattgttctattctcatgcatag |
31102423 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 217 - 302
Target Start/End: Original strand, 31102439 - 31102524
Alignment:
| Q |
217 |
gttcatgtccaaactatgcatttaacaacattgtgttgcttatcaacaaaatatggctgatattgctcctagtcacatattatgca |
302 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31102439 |
gttcatgtcgaaactatgcatttaacaacattgtgttacttatcaacaaaatatggctgatattgctcctagtcacatattatgca |
31102524 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University