View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16818_low_23 (Length: 272)
Name: NF16818_low_23
Description: NF16818
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16818_low_23 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 119; Significance: 7e-61; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 119; E-Value: 7e-61
Query Start/End: Original strand, 15 - 145
Target Start/End: Complemental strand, 32343733 - 32343603
Alignment:
| Q |
15 |
gagatgaagttcattttggttgtaggaatatgcttagtgttgggaatgtcccacaatgcatatggaaggaacttgaagaatgaaaaagaagatgtgaaaa |
114 |
Q |
| |
|
||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32343733 |
gagatgaagttcattttggttgtggggatatgcttagtgttgggaatgtcccacaatgcatatggaaggaacttgaagaatgaaaaagaagatgtgaaaa |
32343634 |
T |
 |
| Q |
115 |
agccggaatggttctttgatacaccttctga |
145 |
Q |
| |
|
||||||||||||||||||||||||| ||||| |
|
|
| T |
32343633 |
agccggaatggttctttgatacaccatctga |
32343603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University