View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16818_low_33 (Length: 216)

Name: NF16818_low_33
Description: NF16818
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16818_low_33
NF16818_low_33
[»] chr1 (1 HSPs)
chr1 (106-206)||(25591577-25591677)


Alignment Details
Target: chr1 (Bit Score: 101; Significance: 3e-50; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 106 - 206
Target Start/End: Complemental strand, 25591677 - 25591577
Alignment:
106 gttgcctttttaatatcctttaatatcctttttattattggaagaagaaagtacatggtggtattattcatttcacgatttttgttggtacaaattgatg 205  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
25591677 gttgcctttttaatatcctttaatatcctttttattattggaagaagaaagtacatggtggtattattcatttcacgatttttgttggtacaaattgatg 25591578  T
206 a 206  Q
    |    
25591577 a 25591577  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University