View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1681_high_42 (Length: 251)
Name: NF1681_high_42
Description: NF1681
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1681_high_42 |
| |
|
Alignment Details
Target: chr1 (Bit Score: 68; Significance: 2e-30; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 9 - 80
Target Start/End: Complemental strand, 18540479 - 18540408
Alignment:
Q |
9 |
gaacctgtgtatgtgatatgtttgttttcaatattatacgttgtgtgactatttgaattggtaatctcatat |
80 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
T |
18540479 |
gaacctgtgtatgtgatatgtttgttttcaatattatacgttgtgtgactatttgaattggtaatcccatat |
18540408 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 9 - 79
Target Start/End: Original strand, 21453536 - 21453606
Alignment:
Q |
9 |
gaacctgtgtatgtgatatgtttgttttcaatattatacgttgtgtgactatttgaattggtaatctcata |
79 |
Q |
|
|
|||| ||||||||||||||||||||||||| | |||| ||| |||||||||||||| ||| ||||| |||| |
|
|
T |
21453536 |
gaacttgtgtatgtgatatgtttgttttcattcttatgcgtggtgtgactatttgatttgttaatcccata |
21453606 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 37; Significance: 0.000000000006; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 9 - 73
Target Start/End: Complemental strand, 25450177 - 25450113
Alignment:
Q |
9 |
gaacctgtgtatgtgatatgtttgttttcaatattatacgttgtgtgactatttgaattggtaat |
73 |
Q |
|
|
|||| ||||||||||||||||||||||||| | |||| ||| |||||||||||||| ||| |||| |
|
|
T |
25450177 |
gaacttgtgtatgtgatatgtttgttttcattcttatgcgtggtgtgactatttgatttgttaat |
25450113 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 9 - 73
Target Start/End: Complemental strand, 43292917 - 43292853
Alignment:
Q |
9 |
gaacctgtgtatgtgatatgtttgttttcaatattatacgttgtgtgactatttgaattggtaat |
73 |
Q |
|
|
|||| ||||||||||||||||||||||||| | |||| ||| |||||||||||||| ||| |||| |
|
|
T |
43292917 |
gaacttgtgtatgtgatatgtttgttttcattcttatgcgtggtgtgactatttgatttgttaat |
43292853 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 9 - 79
Target Start/End: Complemental strand, 25454502 - 25454432
Alignment:
Q |
9 |
gaacctgtgtatgtgatatgtttgttttcaatattatacgttgtgtgactatttgaattggtaatctcata |
79 |
Q |
|
|
|||| |||||||| ||||| |||||||||| | |||| ||| |||||||||||||| ||| ||||| |||| |
|
|
T |
25454502 |
gaacttgtgtatgcgatatatttgttttcattcttatgcgtggtgtgactatttgatttgttaatcccata |
25454432 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 25376 times since January 2019
Visitors: 1346