View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1681_high_67 (Length: 230)
Name: NF1681_high_67
Description: NF1681
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1681_high_67 |
| |
|
Alignment Details
Target: chr4 (Bit Score: 205; Significance: 1e-112; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 12 - 216
Target Start/End: Original strand, 47061622 - 47061826
Alignment:
Q |
12 |
tcatcataggaatttggttaagcttattggtttttgtatagaaggttcaaagaagcttcttgtttatgaatttgtcagcaaagggtctcttgcaaatatc |
111 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
47061622 |
tcatcataggaatttggttaagcttattggtttttgtatagaaggttcaaagaagcttcttgtttatgaatttgtcagcaaagggtctcttgcaaatatc |
47061721 |
T |
|
Q |
112 |
ctctttgaaggggaagtgagactatcttggaaagatagaatgaaacttgcattggacgtggctaaaggaatattatatctacacgaagagtgtgaagtcc |
211 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
47061722 |
ctctttgaaggggaagtgagactatcttggaaagatagaatgaaacttgcattggacgtggctaaaggaatattatatctacacgaagagtgtgaagtcc |
47061821 |
T |
|
Q |
212 |
aaatt |
216 |
Q |
|
|
||||| |
|
|
T |
47061822 |
aaatt |
47061826 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 12 - 211
Target Start/End: Complemental strand, 47080135 - 47079936
Alignment:
Q |
12 |
tcatcataggaatttggttaagcttattggtttttgtatagaaggttcaaagaagcttcttgtttatgaatttgtcagcaaagggtctcttgcaaatatc |
111 |
Q |
|
|
||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||| |||||||||||| || |
|
|
T |
47080135 |
tcatcataggaatttggttaagcttgttggtttttgtatagaaggatcaaagaagctccttgtttatgaatttgtcagcaaaggatctcttgcaaatctc |
47080036 |
T |
|
Q |
112 |
ctctttgaaggggaagtgagactatcttggaaagatagaatgaaacttgcattggacgtggctaaaggaatattatatctacacgaagagtgtgaagtcc |
211 |
Q |
|
|
||||||||||||||| |||||||||||||||||| | |||||||||||||||||| ||||||| ||| | || |||||||||||||||||||| |||| |
|
|
T |
47080035 |
ctctttgaaggggaaacgagactatcttggaaagacaaaatgaaacttgcattggatgtggctagaggtcttttgtatctacacgaagagtgtgatgtcc |
47079936 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 9778 times since January 2019
Visitors: 1248