View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1681_high_78 (Length: 207)
Name: NF1681_high_78
Description: NF1681
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1681_high_78 |
| |
|
Alignment Details
Target: chr6 (Bit Score: 90; Significance: 1e-43; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 19 - 133
Target Start/End: Complemental strand, 1432918 - 1432804
Alignment:
Q |
19 |
gagtttgatcactgacaaaaatggaatttcagaagaaaagnnnnnnngtgttgtgtaataggaaagatagaatctgtgtagaagctatgtcaagcaatca |
118 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
1432918 |
gagtttgatcactgacaaaaatggaatttcagaagaaaagtttttttgtgttgtgtaataggaaagatagaatctgtgaagaagctatgtcaagcaatca |
1432819 |
T |
|
Q |
119 |
aaccaggtggaataa |
133 |
Q |
|
|
||||||||||||||| |
|
|
T |
1432818 |
aaccaggtggaataa |
1432804 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2862 times since January 2019
Visitors: 5816