View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1681_low_42 (Length: 252)
Name: NF1681_low_42
Description: NF1681
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1681_low_42 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 150; Significance: 2e-79; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 17 - 187
Target Start/End: Complemental strand, 31320236 - 31320066
Alignment:
| Q |
17 |
caaaggcgacaaccatttcagaaaataaaatccctaggaaaaatgtcactggcggcactatttggaaaactgcaagaacatgagttgaaactnnnnnnnt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
31320236 |
caaaggcgacaaccatttcagaaaataaaatccctaggaaaaatgtcactggcggcactatttggaaaactgcaagaacatgagttgaaactaaaaaaat |
31320137 |
T |
 |
| Q |
117 |
aagaaaattcttaaagaaagacaagacaatcaaatttgttcaaggaaagagacttgtgaagaataaggaaa |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31320136 |
aagaaaattcttaaagaaagacaagacaatcaaatttgttcaaggaaagagacttgtgaagaataaggaaa |
31320066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 191 - 235
Target Start/End: Complemental strand, 31320042 - 31319998
Alignment:
| Q |
191 |
acttgttttgagtgtgtaaaacacggtcatatcaatgttgattgt |
235 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
31320042 |
acttgttttgagtttgtaaaacacggtcatatcaatgttgattgt |
31319998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University