View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1681_low_46 (Length: 246)
Name: NF1681_low_46
Description: NF1681
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1681_low_46 |
| |
|
Alignment Details
Target: chr7 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 3 - 230
Target Start/End: Original strand, 30896369 - 30896597
Alignment:
Q |
3 |
gatgcccctaacatcaaataaaaaccaacttaagggattcacaagtcattaatattaannnnnnn-ccaaccatgattctaggcaaaccaaaaagataat |
101 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
T |
30896369 |
gatgcccctaacatcaaataaaaaccaacttaagggattcacaagtcattaatattaattttttttccaaccatgattctaggcaaaccaaaaagataat |
30896468 |
T |
|
Q |
102 |
aggccactcattagtattggttgaataggaaaaccatgtttcatatgtacactacatgtacattatttgtttgctttgatttatcccacagagtaaaatt |
201 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
30896469 |
aggccactcattagtattggttgaataggaaaaccatgtttcatatgtacactacatgtacattatttgtttgctttgatttatcccacagagtaaaatt |
30896568 |
T |
|
Q |
202 |
ggtgaaacaattatttgagtgtaatctat |
230 |
Q |
|
|
||||||||||||||||||||||||||||| |
|
|
T |
30896569 |
ggtgaaacaattatttgagtgtaatctat |
30896597 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 6300 times since January 2019
Visitors: 5966