View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1681_low_51 (Length: 240)
Name: NF1681_low_51
Description: NF1681
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1681_low_51 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 18 - 232
Target Start/End: Original strand, 2159028 - 2159242
Alignment:
| Q |
18 |
gaaggaatctctaccgttgggtgaagatcagacaactcatattctcatttcacgtaatcggctttaaaataaatctcagaatacaagtcatctgatcttc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
2159028 |
gaaggaatctctaccgttgggtgaagatcagacaactcatattctcatttcacgtaatcggctttaaaataaatctcagaatacaagtcatcagatcttc |
2159127 |
T |
 |
| Q |
118 |
atttaacagctggaattcacaactgtgtgattacatagagaatccaagttaaaacaaaaaagtcatatcaattgttctactcaaagaattccatgcattg |
217 |
Q |
| |
|
|||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2159128 |
atttaacagctgaaattcacgactgtgtgattacatagagaatccaagttaaaacaaaaaagtcatatcaattgttctactcaaagaattccatgcattg |
2159227 |
T |
 |
| Q |
218 |
aactttacctatgct |
232 |
Q |
| |
|
|||||||||| |||| |
|
|
| T |
2159228 |
aactttacctgtgct |
2159242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University