View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1681_low_64 (Length: 233)
Name: NF1681_low_64
Description: NF1681
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1681_low_64 |
| |
|
Alignment Details
Target: chr5 (Bit Score: 214; Significance: 1e-117; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 218
Target Start/End: Complemental strand, 36354121 - 36353904
Alignment:
Q |
1 |
ttattcaggtgaagattttgttgtcccttgtgccactattattgttgcttgttgttcattgtctctcaagtggagaatcgttcactttacctttgccaga |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
36354121 |
ttattcaggtgaagattttgttgtcccttgtgccactattattgttgcttgttgttcattgtctctcaagtggagaatcgttcactttacctttgccaga |
36354022 |
T |
|
Q |
101 |
ggagagtgaatctttgcatagagctggtggatctccatggggagtggcactcttgcttgtgttcctcttgtctatgatttcttatcagtcttcttttcat |
200 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
T |
36354021 |
ggagagtgaatctttgcatagagctggtggatctccatggggagtggcactcttgcttgtgttcctcttgtttatgatttcttatcagtcttcttttcat |
36353922 |
T |
|
Q |
201 |
gaacgttggtttcctttc |
218 |
Q |
|
|
|||||||||||||||||| |
|
|
T |
36353921 |
gaacgttggtttcctttc |
36353904 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 129; E-Value: 7e-67
Query Start/End: Original strand, 1 - 217
Target Start/End: Complemental strand, 36355407 - 36355191
Alignment:
Q |
1 |
ttattcaggtgaagattttgttgtcccttgtgccactattattgttgcttgttgttcattgtctctcaagtggagaatcgttcactttacctttgccaga |
100 |
Q |
|
|
||||||| |||||||||||||| || |||| |||||| ||||||||||||||||||||||||||||||||| || ||||||| |||||||||||||||| |
|
|
T |
36355407 |
ttattcaaatgaagattttgttggcctttgtaccactaatattgttgcttgttgttcattgtctctcaagtgaaggatcgttccctttacctttgccaga |
36355308 |
T |
|
Q |
101 |
ggagagtgaatctttgcatagagctggtggatctccatggggagtggcactcttgcttgtgttcctcttgtctatgatttcttatcagtcttcttttcat |
200 |
Q |
|
|
|||||| || ||| | ||||||||||||||||| ||||||||||| ||||| |||||||||||||| |||| ||||| || ||||||||||||||||| |
|
|
T |
36355307 |
ggagagagagtctctacatagagctggtggatcaccatggggagttgcactgttgcttgtgttccttttgttcatgatggctcatcagtcttcttttcat |
36355208 |
T |
|
Q |
201 |
gaacgttggtttccttt |
217 |
Q |
|
|
||||||||||||||||| |
|
|
T |
36355207 |
gaacgttggtttccttt |
36355191 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 13680 times since January 2019
Visitors: 1279