View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1682-Insertion-4 (Length: 249)
Name: NF1682-Insertion-4
Description: NF1682
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1682-Insertion-4 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 164; Significance: 9e-88; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 8 - 246
Target Start/End: Complemental strand, 8440356 - 8440120
Alignment:
| Q |
8 |
atattatggcagatatatacaagaaaaatcatggcaagtatatttttcaataaataaatggatcatgggtgtattgcatcaaaataatatgtttcaatcc |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8440356 |
atattatggcagatatatacaagaaaaatcatggcaagtatatttttcaataaataaatggatcatgggtgtattgcatcaaaataatatgtttcaatcc |
8440257 |
T |
|
| Q |
108 |
ttttctaatcatcaaggatggcatataccgttcccttnnnnnnnnnnnnnnnnnnnnnnggatggcatgtataccgtatgttttgatccaaataaagatt |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
8440256 |
ttttctaatcatcaaggatggcatataccgttccctt--aaaaaaaaaaaaaaaaaaaaggatggcatatataccgtatgttttgatccaaataaagatt |
8440159 |
T |
|
| Q |
208 |
gctcttgtttggttgaggttgttgccttgtaaattttgt |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8440158 |
gctcttgtttggttgaggttgttgccttgtaaattttgt |
8440120 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 204 - 249
Target Start/End: Original strand, 19783409 - 19783454
Alignment:
| Q |
204 |
gattgctcttgtttggttgaggttgttgccttgtaaattttgtaaa |
249 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
19783409 |
gattgctcttgtttggttcaggctgttgccttgtaaattttgtaaa |
19783454 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University