View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1682-Insertion-5 (Length: 170)
Name: NF1682-Insertion-5
Description: NF1682
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1682-Insertion-5 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 132; Significance: 4e-69; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 132; E-Value: 4e-69
Query Start/End: Original strand, 7 - 170
Target Start/End: Complemental strand, 34865541 - 34865379
Alignment:
| Q |
7 |
atggatgatgacgcagttgactggctaaatcttcctcgagaattatggttagttattatatccatgaatttgaatccatttgatattwttcgacatccgt |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| || ||||| ||||| |
|
|
| T |
34865541 |
atggatgatgacgcagttgactggctaaatcttcctcgagaattatggttagttattatatccaagaatttgaatccatttgatgttcttcga-ttccgt |
34865443 |
T |
|
| Q |
107 |
agtgtctgtgctttattgcgctctattcttccccctcctttttcttctccttctcacacacttc |
170 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||| |
|
|
| T |
34865442 |
agtgtctgtgctttattgcgctctattcttccccctccttttccttctccttctcatacacttc |
34865379 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 45; Significance: 5e-17; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 45; E-Value: 5e-17
Query Start/End: Original strand, 10 - 70
Target Start/End: Original strand, 51858017 - 51858077
Alignment:
| Q |
10 |
gatgatgacgcagttgactggctaaatcttcctcgagaattatggttagttattatatcca |
70 |
Q |
| |
|
||||||||| | ||||| |||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
51858017 |
gatgatgacacggttgattggctaaatcttcctcgagacttatggttagttattatatcca |
51858077 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.00000000005
Query Start/End: Original strand, 102 - 148
Target Start/End: Original strand, 51858093 - 51858139
Alignment:
| Q |
102 |
tccgtagtgtctgtgctttattgcgctctattcttccccctcctttt |
148 |
Q |
| |
|
||||||||| ||||||||||| ||||||||||||| ||||||||||| |
|
|
| T |
51858093 |
tccgtagtgcctgtgctttatggcgctctattctttcccctcctttt |
51858139 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University