View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16820_low_11 (Length: 247)
Name: NF16820_low_11
Description: NF16820
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16820_low_11 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 10 - 231
Target Start/End: Complemental strand, 34053765 - 34053544
Alignment:
| Q |
10 |
ataatactgtccaactccatctattatgaatcagtttgaataactcaaacttgtccaaaaatacttataggataagaaatactaaaagaacctcgcaaca |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
34053765 |
ataatactgtccaactccatctattatgaatcagtttgaataactcaaacttgtccaaaaatacttataggataagaaatactaaaagaaccttgcaaca |
34053666 |
T |
 |
| Q |
110 |
gttgagtttttcatacaagtagaaattagctcatacatctaattttatttctagaaactctcatttaacttctctatgaacacctataaaggattcattc |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34053665 |
gttgagtttttcatacaagtagaaattagctcatacatctaattttatttctagaaactctcatttaacttctctatgaacacctataaaggattcattc |
34053566 |
T |
 |
| Q |
210 |
gtaagcgaacaccccataaact |
231 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
34053565 |
gtaagcgaacaccccataaact |
34053544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University