View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16821_high_19 (Length: 237)
Name: NF16821_high_19
Description: NF16821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16821_high_19 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 13 - 237
Target Start/End: Original strand, 36833006 - 36833230
Alignment:
| Q |
13 |
tcatttttcatgcagctagaggacatgcatgattgggtgtccacgtcaacccttcatagtgatgggaccaaagggtgcaaaataattattgatattgaat |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36833006 |
tcatttttcatgcagctagaggacatgcatgattgggtgtccacgtcaacccttcatagtgatgggaccaaagggtgcaaaataattattgatattgaat |
36833105 |
T |
 |
| Q |
113 |
aggagcatatcaaaggttggagtcacctttggatcgagagtgattcgtagatagctatttcgaaatctcatgatttggttccttgggaccttcccaatcg |
212 |
Q |
| |
|
| ||||||||||||||||||||||||||| || || ||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||| | |
|
|
| T |
36833106 |
ttgcgcatatcaaaggttggagtcacctttgaattgaaagtgattcgtagataactatttcaaaatctcatgatttggttccttgggaccttcccaattg |
36833205 |
T |
 |
| Q |
213 |
ttggaacaattgctttgcctctcct |
237 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
36833206 |
ttggaacaattgctttgcctctcct |
36833230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 123 - 237
Target Start/End: Original strand, 42068679 - 42068795
Alignment:
| Q |
123 |
caaaggttggagtcacctttggatcgagagtgattcgtagatagctatt--tcgaaatctcatgatttggttccttgggaccttcccaatcgttggaaca |
220 |
Q |
| |
|
|||||||||||||| |||||||| ||||||||||| |||||||||| | |||| |||||||||||| |||||||||||| ||||| || || || |
|
|
| T |
42068679 |
caaaggttggagtcgtctttggattgagagtgattcaccgatagctattcattcaaatttcatgatttggtctcttgggaccttcgcaatcattagagca |
42068778 |
T |
 |
| Q |
221 |
attgctttgcctctcct |
237 |
Q |
| |
|
|||| |||||||||||| |
|
|
| T |
42068779 |
attgttttgcctctcct |
42068795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 175 - 235
Target Start/End: Complemental strand, 9982108 - 9982048
Alignment:
| Q |
175 |
aaatctcatgatttggttccttgggaccttcccaatcgttggaacaattgctttgcctctc |
235 |
Q |
| |
|
|||| ||||||| |||||||||||||||||| ||||| ||||| |||||||||||| |||| |
|
|
| T |
9982108 |
aaatatcatgatatggttccttgggaccttcgcaatcattggagcaattgctttgcttctc |
9982048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University