View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16821_high_20 (Length: 236)
Name: NF16821_high_20
Description: NF16821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16821_high_20 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 84; Significance: 5e-40; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 75 - 218
Target Start/End: Complemental strand, 41896624 - 41896491
Alignment:
| Q |
75 |
gcaccaaccccttgttttatcacnnnnnnnccttcttcttatccattatctaccatgatctaccatgatcctccacctaacattccattccaataaccag |
174 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||| |
|
|
| T |
41896624 |
gcaccaaccccttgttttatcactttttttccttcttcttatccattatctaccat----------gatcctccacctaacattccgttccaataaccag |
41896535 |
T |
|
| Q |
175 |
tagaatcaccttgagttctattttgctgatgttcaaactcacca |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41896534 |
tagaatcaccttgagttctattttgctgatgttcaaactcacca |
41896491 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University