View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16821_low_16 (Length: 278)
Name: NF16821_low_16
Description: NF16821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16821_low_16 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 17 - 263
Target Start/End: Complemental strand, 31881563 - 31881317
Alignment:
| Q |
17 |
atcaaattgacacttatagtccccttacaatgcataaacactcatgagacaacattagcactaataaaactactatgtacatttgatgagaaaattgtac |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31881563 |
atcaaattgacacttatagtccccttacaatgcataaacactcatgagacaagattagcactaataaaactactatgtacatttgatgagaaaattgtac |
31881464 |
T |
|
| Q |
117 |
tatgcttgaatagagacaaaaatattcaagtcctcgtagactttctcaacccatcctaagatcccttaggtgacgctagataactaaagggttcacgata |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31881463 |
tatgcttgaatagagacaaaaatattcaagtcctcatagactttctcaacccatcctaagatcccttaggtgacgctagataactaaagggttcacgata |
31881364 |
T |
|
| Q |
217 |
gcttccaacaattgaggtactcccttaagtctcttaataattccccc |
263 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
31881363 |
gcttccaacaatttaggtactcccttaagtctcttaataatttcccc |
31881317 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University