View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16821_low_17 (Length: 254)
Name: NF16821_low_17
Description: NF16821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16821_low_17 |
 | |
|
| [»] scaffold0001 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0001 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: scaffold0001
Description:
Target: scaffold0001; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 417428 - 417190
Alignment:
| Q |
1 |
ttacatttcagcagtaatctctgctccaacaatgggataatatagcagttatcattaaatgaatgtaagatatcaaatctaaataactattctcatagca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
417428 |
ttacatttcagcagtaatctctgctccaacaatgggataatatagcagttatcattaaaggaatgtaagatatcaaatctaaataactattctcatagca |
417329 |
T |
|
| Q |
101 |
atgagtagagcagaaacttactattttctgaatcctttctaattcatgacaaagtggattatggtacaaaggtggaagattcatcacagatgattgtggt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
417328 |
atgagtagagcagaaacttactattttctgaatcctttctaattcatgacaaagtggtttatggtacaaaggtggaagattcatcacagatgattgtggt |
417229 |
T |
|
| Q |
201 |
gcagcttcaataggatgattcctcaaaccaggatttctt |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
417228 |
gcagcttcaataggatgattcctcaaaccaggatttctt |
417190 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University