View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16823_high_30 (Length: 250)
Name: NF16823_high_30
Description: NF16823
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16823_high_30 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 139; Significance: 8e-73; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 139; E-Value: 8e-73
Query Start/End: Original strand, 78 - 238
Target Start/End: Complemental strand, 28775411 - 28775254
Alignment:
| Q |
78 |
ttaaaagatctttggatgcatttgacctaaattaaattcatattttgatactacttctacttttgtccatcataagtatatgtctgttaggagaaatttc |
177 |
Q |
| |
|
|||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
28775411 |
ttaaaagacctttagatgcatttgacctaaattaaattcatattttgatactacttctacttttgtccat---aagtatatgtctgttaggagaaatttc |
28775315 |
T |
 |
| Q |
178 |
tttgtctcttttacaagaccattcaaattacttgattaacgtacaacgagaagaccattca |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28775314 |
tttgtctcttttacaagaccattcaaattacttgattaacgtacaacgagaagaccattca |
28775254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University