View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16823_low_20 (Length: 330)
Name: NF16823_low_20
Description: NF16823
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16823_low_20 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 260; Significance: 1e-145; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 19 - 315
Target Start/End: Original strand, 45791861 - 45792159
Alignment:
| Q |
19 |
atgttattcttccttctgtgttttacttatctttt--gtcaataggtatttttgaaaactagcctttcacaattcagtttattctttgttgcaggaaatt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
45791861 |
atgttattcttccttctgtgttttacttattttttttgtcaataggtatttttgaaaactagcctttcacaattcagtttattttttgttgcaggaaatt |
45791960 |
T |
 |
| Q |
117 |
tcaaaattgaggtatgagttgtgtccactcgtcatgaaagagaggaagttttggagaatatattttatacttgtgaataatcatgttgcaccgtcagtag |
216 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||| ||||| |
|
|
| T |
45791961 |
tcaaaattgaggtatgagttgtgtccacatgtcatgaaagagaggaagttttggagaatatattttatacttgtgaataatcatatcgcaccgtaagtag |
45792060 |
T |
 |
| Q |
217 |
tttatactattgcttgagtattttggttttcgcataaattttgttatttgacatttgtctgaccaagataaatccaatacaaggactatttggtctttg |
315 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45792061 |
tttatactattgcttgagtattttggttttcgcataaattttgttatttgacatttgtctgaccaagataaatccaatacaaggactatttggtctttg |
45792159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University