View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16823_low_21 (Length: 316)
Name: NF16823_low_21
Description: NF16823
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16823_low_21 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 67; Significance: 9e-30; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 7 - 93
Target Start/End: Original strand, 17426936 - 17427021
Alignment:
| Q |
7 |
taaagataaaaccattcatcacttactttaggtgtttgaattccttaccactcagaccaaccactttgagatataattgaatttttc |
93 |
Q |
| |
|
|||||||||||||||||||| | | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17426936 |
taaagataaaaccattcatc-catgttttaggtgtttgaattccttaccactcagaccaaccactttgagatataattgaatttttc |
17427021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 132 - 160
Target Start/End: Complemental strand, 17427047 - 17427019
Alignment:
| Q |
132 |
agaagaattgatttaatttaaatgaggaa |
160 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
17427047 |
agaagaattgatttaatttaaatgaggaa |
17427019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University