View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16823_low_23 (Length: 294)
Name: NF16823_low_23
Description: NF16823
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16823_low_23 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 258; Significance: 1e-144; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 258; E-Value: 1e-144
Query Start/End: Original strand, 20 - 281
Target Start/End: Complemental strand, 26536716 - 26536455
Alignment:
| Q |
20 |
acatgcatagaactatctgatccaacgtccgacccaccaagtaaatcacgcttctcaacatcactttcttctttcaattcattaacctcacaaccaacac |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26536716 |
acatgcatagaactatctgatccaacgtccgacccaccaagtaaatcacgcttctcaacatcactttcttctttcaattcattaacctcacaaccaacac |
26536617 |
T |
 |
| Q |
120 |
tcaaaccattgttgcaaacagtcttttgtgtgtttgacttgtaacttgtgtgcttccaatgagccatccatggtgatagataactataaccatgcattgc |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26536616 |
tcaaaccattgttgcaaacagtcttttgtgtgtttgacttgtaacttgtgtgcttccaatgagccatccatggtgatagataactataaccatgcattgc |
26536517 |
T |
 |
| Q |
220 |
agcatccactctttcaccatcgcgatatgcacgagcagcaatctcatccggcatcatcactc |
281 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
26536516 |
agcatccactctttcaccatcgcgatatgcgcgagcagcaatctcatccggcatcatcactc |
26536455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University