View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16823_low_27 (Length: 283)
Name: NF16823_low_27
Description: NF16823
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16823_low_27 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 151; Significance: 6e-80; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 151; E-Value: 6e-80
Query Start/End: Original strand, 71 - 264
Target Start/End: Complemental strand, 33042452 - 33042258
Alignment:
| Q |
71 |
tctgtttagtgctaacaatttccttctcataaaaaatctaataattggagggtaagaagttaaaactatcagattttgatcttgaatttggttcatgaca |
170 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33042452 |
tctgtttagtgctaacaatttccttctcataacaaatctaataattggagggtaagaagttaaaactatcagattttgatcttgaatttggttcatgacc |
33042353 |
T |
 |
| Q |
171 |
gaacctcattaatcatataac-nnnnnnnncccctttcatccaagtgaccttgtgcaataaagtaaggtagtaaataagacgaacccccaaacaa |
264 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33042352 |
gaacctcattaatcatataactttttttttcccctttcatccaagtgaccttgtgtaataaagtaaggtagtaaataagacgaacccccaaacaa |
33042258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University