View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16823_low_31 (Length: 274)
Name: NF16823_low_31
Description: NF16823
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16823_low_31 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 15 - 253
Target Start/End: Complemental strand, 26536428 - 26536187
Alignment:
| Q |
15 |
cacagaccaattttatgacctcacaaaacagtcaaatcattcataacctgaattttcaagacaatgaattagcttccattnnnnnnncatcacatgcaga |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
26536428 |
cacagaccaattttatgacctcacaaaacagtcaaatcattcataacctgaattttcaagacaatgaattagcttccattaaaaaaacatcacatgcaga |
26536329 |
T |
|
| Q |
115 |
tgcagatagaaacgatcaaaaccagatcacaactacctaacatatacatgc---nnnnnnnnnncataatcatgttcttaatcttacctaacacacataa |
211 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
26536328 |
tgcagatagaaacaatcaaaaccagatcacaactacctaacatatacatgcaaaaaaaaaaaagcataatcatgttcttaatcttacctaacacacataa |
26536229 |
T |
|
| Q |
212 |
atcactactaaatcatcaaattcgcattagttaattgtgttt |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26536228 |
atcactactaaatcatcaaattcgcattagttaattgtgttt |
26536187 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University