View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16823_low_40 (Length: 208)
Name: NF16823_low_40
Description: NF16823
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16823_low_40 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 76; Significance: 2e-35; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 76; E-Value: 2e-35
Query Start/End: Original strand, 119 - 198
Target Start/End: Complemental strand, 1252386 - 1252307
Alignment:
| Q |
119 |
aaaatggaattgcagtttgtgcttagcacaggaaatggagtgaatggtttcacacttgatccttcccttggagagttcat |
198 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1252386 |
aaaatggaactgcagtttgtgcttagcacaggaaatggagtgaatggtttcacacttgatccttcccttggagagttcat |
1252307 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 15 - 66
Target Start/End: Complemental strand, 1252490 - 1252439
Alignment:
| Q |
15 |
agctcttgcacggtaaaactagcaccgattatgcaaatagaatgttataaag |
66 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1252490 |
agctcttgcacggtaaaactagcaccgattatgcaaatagaatgttataaag |
1252439 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University