View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16823_low_40 (Length: 208)

Name: NF16823_low_40
Description: NF16823
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16823_low_40
NF16823_low_40
[»] chr2 (2 HSPs)
chr2 (119-198)||(1252307-1252386)
chr2 (15-66)||(1252439-1252490)


Alignment Details
Target: chr2 (Bit Score: 76; Significance: 2e-35; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 76; E-Value: 2e-35
Query Start/End: Original strand, 119 - 198
Target Start/End: Complemental strand, 1252386 - 1252307
Alignment:
119 aaaatggaattgcagtttgtgcttagcacaggaaatggagtgaatggtttcacacttgatccttcccttggagagttcat 198  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1252386 aaaatggaactgcagtttgtgcttagcacaggaaatggagtgaatggtttcacacttgatccttcccttggagagttcat 1252307  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 15 - 66
Target Start/End: Complemental strand, 1252490 - 1252439
Alignment:
15 agctcttgcacggtaaaactagcaccgattatgcaaatagaatgttataaag 66  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||    
1252490 agctcttgcacggtaaaactagcaccgattatgcaaatagaatgttataaag 1252439  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University