View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16824_high_2 (Length: 297)
Name: NF16824_high_2
Description: NF16824
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16824_high_2 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 1 - 280
Target Start/End: Complemental strand, 44999016 - 44998741
Alignment:
| Q |
1 |
atatgaaaatcccagttgaatgaatgggaagttgtgatgggacccattaggagagtccctgagtcgtcacgtgttcggatgaacgtgtcacggcaagaaa |
100 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44999016 |
atatgaaaatcccagttgaatg----ggaagttgtgatgggacccattaggagagtccctgagtcgtcacgtgttcggatgaacgtgtcacggcaagaaa |
44998921 |
T |
 |
| Q |
101 |
gtactgttcaaacggttcgtgaaggaactatacactactacacaacacaggaatctgactggtttcaagtcagagtcagattcagaagaagatagatcca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44998920 |
gtactgttcaaacggttcgtgaaggaactatacactactacacaacacaggaatctgactggtttcaagtcagagtcagattcagaagaagatagatcca |
44998821 |
T |
 |
| Q |
201 |
catagatatgacgagaaagtacaacaaattcaattgaaatatatatcaaaaatgttgttagggcatggtatagtatacct |
280 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||| |||||||||||||||||||| |
|
|
| T |
44998820 |
catagatatgacgagaaagtacaacaaattcaattaaaatatatatgaaaaatgttgttcgggcatggtatagtatacct |
44998741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University