View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16824_high_6 (Length: 216)
Name: NF16824_high_6
Description: NF16824
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16824_high_6 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 116; Significance: 3e-59; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 116; E-Value: 3e-59
Query Start/End: Original strand, 57 - 201
Target Start/End: Complemental strand, 19246814 - 19246668
Alignment:
| Q |
57 |
gtgcatagaatggatacattaactatatta--gttttttaatatatataaaattgataagaaaaacttataataagagacgaaaatactattatatagca |
154 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||| | |||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
19246814 |
gtgcatagaatggatacattaactatattatagttttttaatatatataatactgataagaaaaacttataataagagacgaaaagactattatatagca |
19246715 |
T |
 |
| Q |
155 |
ccaaatacgtcgttctgttactccaagtataatgttttgggcgatga |
201 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||| |||| |
|
|
| T |
19246714 |
ccaaatacgtcgttgtgttactccaagtataatgttttgggctatga |
19246668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University