View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16824_low_4 (Length: 294)
Name: NF16824_low_4
Description: NF16824
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16824_low_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 11 - 278
Target Start/End: Complemental strand, 42932395 - 42932128
Alignment:
| Q |
11 |
atcacatttgcagaaacagttccaaacctgattaaggatgaagcaaccaactttagttattgtgaaaatgataacaggataagcatcacgacgcaattag |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
42932395 |
atcacatttgcagaaacagttccaaacctgattaaggatgaagcaaccgactttagttattgttaaaatgataacaggataagcatcacgacgcaattag |
42932296 |
T |
 |
| Q |
111 |
aaacatgatgatttaaaacttacgaacaatctgcaggataaccattgatttctctgcaaccccctttagggcatagatacctaaaatcattcaatggata |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
42932295 |
aaacatgatgatttaaaacttacgaacaatctgcaggataaccattgatttctctgcaaccccctttagggcaaagatacctaaaatcattcaatggata |
42932196 |
T |
 |
| Q |
211 |
ttgatattagttgagaaaaacacctactttatgcatcacatgaaaagtttattaggcaaggtacttac |
278 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42932195 |
ttgatattagttgaggaaaacacctactttatgcatcacatgaaaagtttattaggcaaggtacttac |
42932128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University