View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16825_high_16 (Length: 306)
Name: NF16825_high_16
Description: NF16825
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16825_high_16 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 176; Significance: 8e-95; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 176; E-Value: 8e-95
Query Start/End: Original strand, 49 - 289
Target Start/End: Original strand, 37599879 - 37600118
Alignment:
| Q |
49 |
aaaattgcacaactgcgacaacaagatttnnnnnnnnt--tatcatacaggaggccaaagtacgaactaaatggaaatttatatttcaagaaccaaaagg |
146 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37599879 |
aaaattgcacaactgcgacaacaagatttaaaaaaaaaaatatcatacaggaggccaaagtgcgaactaaatggaaatttatatttcaagaaccaaaagg |
37599978 |
T |
 |
| Q |
147 |
tttattcagacataactgcaaaatttgttgcaaaaaa-caacataatatattaaggaacacaaccacaatggagaagaggcacaattattttttctaatg |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37599979 |
tttattcagacataactgcaaaatttgttgcaaaaaaacaacataat----taaggaacacaaccacaatggagaagaggcacaattattttttctaatg |
37600074 |
T |
 |
| Q |
246 |
gcaatcgaaggatatcactagcaaaacgctacgacacataaact |
289 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37600075 |
gcaatcgaaggatatcactagcaaaacgctacgacacataaact |
37600118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University