View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16826_high_3 (Length: 294)
Name: NF16826_high_3
Description: NF16826
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16826_high_3 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 18 - 233
Target Start/End: Complemental strand, 35850273 - 35850060
Alignment:
| Q |
18 |
ggattgatgggctacatggtgagaaatggaacctaattcatgggttgatctgtgtgttggacttagtactgcaaagtaaatatgaataaatgtcaaaata |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35850273 |
ggattgatgggctacatggtgagaaatggaacctaattcatgggttgatctgtgtgttggacttagtactgcaaagtaaatatgaataaatgtcaaaata |
35850174 |
T |
|
| Q |
118 |
aacaaaatcggctaaaataaagttacccctatgcccttgtaatactttcattttgaacacacagtacannnnnnnnnaattagacctactctcttctgta |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
35850173 |
aacaaaatcggctaaaataaagttacccctatgcccttgtaatactttcattttgaacacacagtaca--tttttttaattagacctactctcttctgta |
35850076 |
T |
|
| Q |
218 |
attactaaaatataat |
233 |
Q |
| |
|
|||||||| ||||||| |
|
|
| T |
35850075 |
attactaatatataat |
35850060 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University