View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16826_high_4 (Length: 276)
Name: NF16826_high_4
Description: NF16826
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16826_high_4 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 112 - 263
Target Start/End: Original strand, 33107396 - 33107547
Alignment:
| Q |
112 |
cttaccttttttgcttcatcttgagctgaaaatgtacaattttctttccaagagcttagaacaaaaagggtatgcttctccatatctttcaaaaaatgtg |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33107396 |
cttaccttttttgcttcatcttgagctgaaaatgtacaattttctttccaagagcttagaacaaaaagggtatgcttctccatatctttcaaaaaatgtg |
33107495 |
T |
|
| Q |
212 |
ttttaagcctagcatagctcataaagtttagtgatatattcctcatttccct |
263 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33107496 |
ttttaagcctagcatagctcataaagtttagtgatatattcctcatttccct |
33107547 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 113 - 251
Target Start/End: Complemental strand, 7618440 - 7618302
Alignment:
| Q |
113 |
ttaccttttttgcttcatcttgagctgaaaatgtacaattttctttccaagagcttagaacaaaaagggtatgcttctccatatctttcaaaaaatgtgt |
212 |
Q |
| |
|
|||||||||| |||||||||||||||| |||||| ||||| |||||||| |||| ||||| | ||||||| ||||| | |||||||| | |||||| |
|
|
| T |
7618440 |
ttacctttttagcttcatcttgagctgcaaatgtggttttttccttccaagaacttaaaacaagacgggtatgtttctcaacctctttcaatagatgtgt |
7618341 |
T |
|
| Q |
213 |
tttaagcctagcatagctcataaagtttagtgatatatt |
251 |
Q |
| |
|
| |||||||||||| | || ||| || ||||||||||| |
|
|
| T |
7618340 |
tctaagcctagcatgacacaaaaaattgagtgatatatt |
7618302 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University