View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16827_high_6 (Length: 244)
Name: NF16827_high_6
Description: NF16827
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16827_high_6 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 118; Significance: 3e-60; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 1 - 122
Target Start/End: Original strand, 5360019 - 5360140
Alignment:
| Q |
1 |
gtgaaattagtaagcagcaatgaaccattttgttctatagcttcagcagcctcatcttcatcacttcacctaaaatcaagaaaacaaggactacacatat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
5360019 |
gtgaaattagtaagcagcaatgaaccattttgttctatagcttcagcagcctcatcttcatcacttcacctaaaatcaagaaaacaaggactacacattt |
5360118 |
T |
|
| Q |
101 |
tttcagcagggtttttctcatt |
122 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
5360119 |
tttcagcagggtttttctcatt |
5360140 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 1 - 74
Target Start/End: Complemental strand, 5505935 - 5505862
Alignment:
| Q |
1 |
gtgaaattagtaagcagcaatgaaccattttgttctatagcttcagcagcctcatcttcatcacttcacctaaa |
74 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
5505935 |
gtgaaattagtaagcagcaatgaaccattttgttctatagcctcagcagcctcatcttcatcacttcacctaaa |
5505862 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University