View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16828_high_16 (Length: 213)
Name: NF16828_high_16
Description: NF16828
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16828_high_16 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 139; Significance: 6e-73; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 139; E-Value: 6e-73
Query Start/End: Original strand, 44 - 197
Target Start/End: Original strand, 28591779 - 28591933
Alignment:
| Q |
44 |
tgatccttcgcaagaagctgttttgaatatgaagtgtaattgtcatataagataagagtaggacatctgcttgttgaagcattggtcactttcccag-tt |
142 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| || |
|
|
| T |
28591779 |
tgatacttcgcaagaagctgttttgaatatgaagtgtaattgtcatataagataagagtaggacatctgcttattgaagcattggtcactttcccagttt |
28591878 |
T |
 |
| Q |
143 |
agaaaataattttataatcttccaaacttgaaactattcaaaatatacagtacgt |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28591879 |
agaaaataattttataatcttccaaacttgaaactattcaaaatatacagtacgt |
28591933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University