View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16828_high_9 (Length: 321)
Name: NF16828_high_9
Description: NF16828
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16828_high_9 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 285; Significance: 1e-160; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 285; E-Value: 1e-160
Query Start/End: Original strand, 1 - 300
Target Start/End: Complemental strand, 36223653 - 36223353
Alignment:
| Q |
1 |
gtaccaagaagtggactcatatattgatttgggcacattacctggaaatttaacagaggttataaaaatttatgagttcattcattatttt-ttcttctt |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||| |
|
|
| T |
36223653 |
gtaccaagaagtggactcatatattgatttgggcacattacctggaaatttaacagaggttataaaaatttatgagttcattcattattttatttttctt |
36223554 |
T |
 |
| Q |
100 |
cttatgaacatttggtttgttaaaatggcctaaatggaacctttttattttcaggatgagatgaagcaacttgaaaggaatgagaaggtggcaatttatt |
199 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36223553 |
cttatgaacaattggtttgttaaaatggcctaaatggaacctttttattttcaggatgagatgaagcaacttgaaaggaatgagaaggtggcaatttatt |
36223454 |
T |
 |
| Q |
200 |
tatctaacatagggaacatggtgctatttgtagcaaaagtttatgcttcaattcaaagtagatctttggctgtgattgcatcaactttggactcactctt |
299 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36223453 |
tatctaacatagggaacatggtgctatttgtagcaaaagtttatgcttcaattcaaagtagatctttggctgtgattgcatcaactttggactcactctt |
36223354 |
T |
 |
| Q |
300 |
g |
300 |
Q |
| |
|
| |
|
|
| T |
36223353 |
g |
36223353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University