View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16828_low_11 (Length: 247)
Name: NF16828_low_11
Description: NF16828
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16828_low_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 107; Significance: 9e-54; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 9 - 127
Target Start/End: Original strand, 28959279 - 28959397
Alignment:
| Q |
9 |
gacatgaagaaacccaaccgtgaatgttgttgttttaagattaagtgagttaaacaatcaagatttaaacttggtgaaggacaaaatactaacatattta |
108 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28959279 |
gacatgaagaaacccaaccatgaatgttgttgttttaagattaaatgagttaaacaatcgagatttaaacttggtgaaggacaaaatactaacatattta |
28959378 |
T |
 |
| Q |
109 |
cttatctaaaaaatatatc |
127 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
28959379 |
cttatctaaaaaatatatc |
28959397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 178 - 221
Target Start/End: Original strand, 28959448 - 28959491
Alignment:
| Q |
178 |
aacaattgagcctgctccagctccacaatattcaaaaacatgta |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28959448 |
aacaattgagcctgctccagctccacaatattcaaaaacatgta |
28959491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University