View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16829_high_13 (Length: 253)
Name: NF16829_high_13
Description: NF16829
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16829_high_13 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 95 - 237
Target Start/End: Original strand, 8218820 - 8218962
Alignment:
| Q |
95 |
gtaaagctagcacttcaacaggcccctccgaataacaaatacttttcaattcctttttctctaaattctacaaaactgtgtttttccagtagaatataat |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8218820 |
gtaaagctagcacttcaacaggcccctccgaataacaaatacttttcaatttctttttctctaaattctacaaaactgtgtttttccagtagaatataat |
8218919 |
T |
 |
| Q |
195 |
tagtcattaaagtaaatcaactcaatccaattagtagcatatt |
237 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8218920 |
tagtcgttaaagtaaatcaactcaatccaattagtagcatatt |
8218962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University